gmane.comp.lang.perl.bio.general

Bio::Coordinate::Collection could DoWhatIMean better (w/ patch)


Hi all,

Bio::Coordinate::Collection surprised me a bit.  At first I thought
there was a bug, but it's clearly doing what it's supposed to.  Now
I'm wondering if what it's supposed to be doing makes sense in some
context, or if what I expected would be better functionality.

t/CoordinateMapper.t sets up the following scenario:

#
# Collection
#
#         1   5     6   10
#         |---|     |---|
#-----|-----------------------
#     1   5   9     15  19
#         pair1     pair2

Then goes on to do the following query:

  # match more than two
  $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
  ok $res = $transcribe->map($pos);
  is $res->each_gap, 2;
  is $res->each_match, 2;

I was surprised to see that there were two gaps, one gene:10-19 and
one from gene:5-14.  Looking at the code, what's really happening is
that, for the exon1 mapper there's match with gene:5-9 and a gap with

(Continue reading)

headers

George Hartzell | 4 Sep 01:17

What's up with line 248 of Bio::Coordinate::Pair?


Ok, confess.  None of you know what's up with line 248 of
Bio::Coordinate::Pair, do you?  You probably don't even know what's
*on* that line.  Wonder how many will go look.

Now that I either have your attention or have pissed you off (or
both...), I think that creating a new Bio::Location::Split object in
Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
quite sure enough to excise it and commit the change.

Anyone up for it?

g.

headers

Gundala Viswanath | 3 Sep 16:45

Fitch's Parsimony Algorithm with Perl

Hi,

What's a correct way to implement Fitch's parsimony algorithm?
Especially to compute minimum substitiution rate per column
in the aligned sequence.

Is there a Bioperl module to do it?

For example
CGGCGGAAAACTGTCCTCCGTGC   mouse
CGACGGAACATTCTCCTCCGCGC   rat
CGACGGAATATTCCCCTCCGTGC   human
CGACGGAAGACTCTCCTCCGTGC   chimp

00100000302011000000100   -> number of subst per site (max parsimony)

My code below doesn't seem to do the job.

__BEGIN__
use Data::Dumper;
use List::MoreUtils qw(uniq);

# The related phylogenetic in Newick format tree is:
my $tree = ' (mouse,rat,(human,chimp))';

my $sites = [
    'CGGCGGAAAACTGTCCTCCGTGC', # mouse
    'CGACGGAACATTCTCCTCCGCGC', # rat
    'CGACGGAATATTCCCCTCCGTGC', # human
    'CGACGGAAGACTCTCCTCCGTGC', # chimp

(Continue reading)

headers

John Osborne | 3 Sep 16:32

interpro parsing enhancement?

Hi -
I'm wondering if anyone is working on adding functionality to
Bio::SeqIO::interpro to grab the Gene Ontology/GO classifications out
of the interpro xml output?

I've started working on that myself, but wanted to check if anyone
else is doing the same.

Thanks!
--

-- 
John Osborne
osborne6 <at> ieee.org/osborne6 <at> gmail.com/jro <at> freeshell.org

headers

Laurent Manchon | 3 Sep 15:02

parsing result of CAP3 (ACE file)

-- Hi,

Is somebody have a piece of code to parse result of CAP3 assembly program which
format is ACE ?
I need to retrieve the alignment from this file.

thank you,
Laurent --

+---------------------------------------------+
  Laurent Manchon
  Email: lmanchon <at> univ-montp2.fr
+---------------------------------------------+

headers

Jason Stajich | 1 Sep 09:42

Re: Bio::Tools::dpAlign feature request

Safe to ignore the tests.  Those that are failing aren't even test for  
Bio::Align::dpAlign - but were written to test a bug that has not been  
fixed in the EVD module if I remember correctly that is why they are  
marked in a TODO block, but I can't tell if the Test.pm is actually  
skipping these tests or not.

I think we probably need to deprecate some of these modules as there  
is no maintainer of Ewan's code in here.

At a minimum we need to modularlize the tests for these modules into  
separate t dir and fix the need for multiple Makefile.PL in here and  
probably move to Build.PL

-jason
On Aug 28, 2008, at 11:00 AM, Yee Man Chan wrote:

>
> Hi Alexie
>
> My understanding is that you can ignore these failures.
>
> I believe test cases 17-20 were added by Jason Stajich before I  
> added the feature you requested. I am not sure what he was doing  
> there.
>
> I suppose he can give you the definite answer to whether this is  
> something important or not.
>
> By the way, did you try out the new feature? Does it work?
>

(Continue reading)

headers

Dominic Rose | 25 Aug 12:40

Bio::Align::DNAStatistics.pm

Hi,

just a short suggestion to improve the code:

in function

sub _build_nt_matrix()

one finds the following lines:

         my $ti_index = $NucleotideIndexes{$ti};
         my $tj_index = $NucleotideIndexes{$tj};

         if( ! defined $ti_index ) {
             print "ti_index not defined for $ti\n";
             next;
         }

However, it should be possible to avoid the printing of that error 
message. Many alignments contain N's what causes many many
"ti_index not defined for N" messages. It should be possible to switch 
that message off.

Thanks,
Dominic

--

-- 
Dominic Rose
Professur für Bioinformatik
Institut für Informatik

(Continue reading)

headers

Joshua Udall | 29 Aug 08:45

DB_File and assembly IO

Bioperl -

I'm trying to read/parse a single cap3 ace file with several thousand
contigs.  I get a DB_File error at Contig247.  Here's the error:

------------- EXCEPTION -------------
MSG: Unable to tie DB_File handle
STACK Bio::SeqFeature::Collection::new
/Users/jaudall/bin/src/bioperl-live/Bio/SeqFeature/Collection.pm:195
STACK Bio::Assembly::Contig::new
/Users/jaudall/bin/bioperl-live/Bio/Assembly/Contig.pm:256
STACK Bio::Assembly::IO::ace::next_assembly
/Users/jaudall/bin/src/bioperl-live/Bio/Assembly/IO/ace.pm:148
STACK toplevel /Users/jaudall/bin/read_ace.pl:214
-------------------------------------

Looking at the Collection::new, the error is on the middle line:

  $self->{'_btree'} = tie %{$self->{'_btreehash'}}, 'DB_File',
$self->indexfile, O_RDWR|O_CREAT, 0640, $DB_BTREE;  # or die "Cannot open
file: $!\n" ;
  $self->{'_btree'} || $self->throw("Unable to tie DB_File handle");
  return $self;

If I uncomment out the $! die statement that I inserted, I get this:

'Cannot open file tree: Too many open files'

Apparently the Collection constructor is creating a new index file for each
one and the handles for each are sticking around?  That confuses me because

(Continue reading)

headers

Mauricio Herrera Cuadra | 28 Aug 19:40

Pdoc updates

For those who use the online Pdoc documentation (doc.bioperl.org), this 
is to let you know that the CvsWeb links at the top of any module page 
now link to the proper place in the SVN web interface.

Cheers,
Mauricio.

headers

Giles Weaver | 27 Aug 12:39

Re: Bioperl Primer3 Tm calculation of a pre-defined primer

Hi Tony,

It isn't well documented, but Primer3 includes a program called oligotm,
which is used to calculate the Tm of short sequences (up to 32bp). You can
run it directly by typing something like "oligotm ACGTACGTACGTACGT" in the
terminal. Just typing oligotm will give you the options.

If you are using Linux, these snippets of code may help you call oligotm
from within a perl script:

use IPC::Open3;

sub _run_oligotm
{
    my ($class, $sequence) = @_;

    my $run = "oligotm -tp 1 -sc 1 $sequence";
    my $pid = open3(\*WTRFH, \*RDRFH, \*ERRFH, $run);
    close (WTRFH);

    my ($tm, $errors);
    while (<RDRFH>) { $tm .= $_;}
    while (<ERRFH>) { $errors .= $_;}
    chomp $tm;
    return ($tm, $errors);
}

You'll need to put this in a package or edit out the $class bit for it to
work.

(Continue reading)

headers

Dominic Rose | 22 Aug 15:32

Bio::Align::DNAStatistics.pm

Hi,

just a short suggestion to improve the code:

in function

sub _build_nt_matrix()

one finds the following lines:

         my $ti_index = $NucleotideIndexes{$ti};
         my $tj_index = $NucleotideIndexes{$tj};

         if( ! defined $ti_index ) {
             print "ti_index not defined for $ti\n";
             next;
         }

However, it should be possible to stop/silence the printing of that 
error message. Many alignments contain N's what causes many many
"ti_index not defined for N" messages. That should be avoidable.

Thanks,
Dominic

--

-- 
Dominic Rose
Professur für Bioinformatik
Institut für Informatik
Universität Leipzig

(Continue reading)

Mon	Tue	Wed	Thu	Fri	Sat	Sun

1	2	3	4	5	6	7
8	9	10	11	12	13	14
15	16	17	18	19	20	21
22	23	24	25	26	27	28
29	30