Shyam Saladi | 12 Feb 22:24 2013

Bio::Tools::SeqStats->count_codons

Hi,

I am using the count_codons method from Bio::Tools::SeqStats and keep
getting "AMBIGUOUS" codons, but I can't figure out why exactly.

When I translate the same sequence that gives the error using another
standard utility like (ExPASy - Translate), it seems to work alright.

An example sequence is below. Could anyone lend some insight?

Thanks,
Shyam

AAA     AAC     AAG     AAT     ACA     ACC     ACG     ACT     AGA     AGC
    AGT     *AMBIGUOUS*       ATA     ATC     ATG     ATT     CAA     CAC
  CAG     CAT     CCA     CCC     CCG     CCT     CGA     CGC     CGG
CGT     CTA     CTC     CTG     CTT     GAA     GAC     GAG     GAT     GCA
    GCC     GCG     GCT     GGA     GGC     GGG     GGT     GTA     GTC
GTG     GTT     TAA     TAC     TAT     TCA     TCC     TCG     TCT     TGG
    TGT     TTA     TTC     TTG     TTT     count   filename
1.722488038277511961722488038277511961722
2.966507177033492822966507177033492822967
1.531100478468899521531100478468899521531
0.9569377990430622009569377990430622009569
 0.4784688995215311004784688995215311004785
 1.722488038277511961722488038277511961722
1.33971291866028708133971291866028708134
 1.913875598086124401913875598086124401914
0.1913875598086124401913875598086124401914
 0.7655502392344497607655502392344497607656
 1.435406698564593301435406698564593301435       *
0.09569377990430622009569377990430622009569*
0.3827751196172248803827751196172248803828
 2.488038277511961722488038277511961722488
3.349282296650717703349282296650717703349
3.636363636363636363636363636363636363636
2.870813397129186602870813397129186602871
0.3827751196172248803827751196172248803828
 1.626794258373205741626794258373205741627
0.4784688995215311004784688995215311004785
 1.722488038277511961722488038277511961722
0.5741626794258373205741626794258373205742
 1.052631578947368421052631578947368421053
1.244019138755980861244019138755980861244
0.3827751196172248803827751196172248803828
 0.7655502392344497607655502392344497607656
 0.1913875598086124401913875598086124401914
 2.488038277511961722488038277511961722488
0.4784688995215311004784688995215311004785
 0.6698564593301435406698564593301435406699
 2.105263157894736842105263157894736842105
0.8612440191387559808612440191387559808612
 2.870813397129186602870813397129186602871
1.435406698564593301435406698564593301435
1.722488038277511961722488038277511961722
2.775119617224880382775119617224880382775
2.00956937799043062200956937799043062201
 2.488038277511961722488038277511961722488
3.540669856459330143540669856459330143541
2.00956937799043062200956937799043062201
 0.1913875598086124401913875598086124401914
 2.392344497607655502392344497607655502392
0.8612440191387559808612440191387559808612
 5.454545454545454545454545454545454545455
1.913875598086124401913875598086124401914
0.8612440191387559808612440191387559808612
 4.593301435406698564593301435406698564593
2.679425837320574162679425837320574162679
0.09569377990430622009569377990430622009569
1.148325358851674641148325358851674641148
1.148325358851674641148325358851674641148
0.8612440191387559808612440191387559808612
 0.4784688995215311004784688995215311004785
 2.105263157894736842105263157894736842105
0.9569377990430622009569377990430622009569
 0.9569377990430622009569377990430622009569
 0.09569377990430622009569377990430622009569
2.679425837320574162679425837320574162679
2.966507177033492822966507177033492822967
3.062200956937799043062200956937799043062
2.775119617224880382775119617224880382775       1045    temp.seq

ATGGCACGTTTTTTTATTGATCGTCCCATCTTTGCGTGGGTGATCGCCTTAATTATTATGTTGGCGGGGGTGCTTTCAATTCGCACCCTGCCGGTTTCTCAATATCCCAGCATTGCACCGCCAACCGTGGTGATCAGTGCTAACTACCCTGGTGCATCGGCCAAGATTGTTGAAGACTCAGTGACTCAGGTGATTGAGCAACGCATGAAGGGTATCGATCACCTACGTTATATTGCCTCAACCAGCGATAGTTTCGGTAATGCTGAAATCACTTTGACCTTCAATGCCGAAGCCGATCCTGATATTGCTCAGGTACAAGTTCAGAACAAATTGCAGGGTGCAATGACCCTGTTACCACAAGAGGTACAGGCTCAAGGGGTTGACGTTAACAAATCAAGTTCTGGCTTYTTGATGGTGCTGGGTTTCGTATCGACTGACGGTTCCTTAGATAAAGGCGACATCGCCGACTATGTGGGTGCAAACGTACAAGATCCCATGAGCCGTGTACCGGGCGTGGGTGAAATTCAGCTGTTTGGTGCCCAATATGCGATGCGTATATGGCTTGATCCTTTAAAACTGACTCAATATAACTTGACCAGTTTAGAGGTGATCTCGGCGATTCGTGCTCAAAACGCGCAGGTGTCTGCGGGTCAGTTGGGTGGTACGCCGTCAATTCAAGGGCAAGAACTTAACGCCACTGTTTCGGCGCAAAGTCGTTTGCAAACCCCTGAAGAGTTTCGCAAGATTATCCTGAAGTCTGATACTTCGGGTGCGAATGTGTTCCTCGGTGATGTGGCGCG
 CGTAGAGTTAGGTTCAGAGAGTTATGCCGTTGTCTCGTTCTACAATGGTAAGCCTGCTACTGGTTTAGCGATTAAACTGGCGACAGGCGCAAACGCGTTGGATACCGCTGAAGCTGTTCGTGATAAAGTTGAAGAATTGCGACCTTTCTTCCCGCAAGGGTTGGATGTTGTTTATCCCTACGATACTAC!
 GCCATTCGTTGAGAAATCGATAGAAGGCGTGGTACACACCCTGCTCGAAGCGATTGTTCTGGTGTTTGTCATCATGTACCTCTTCCTGCAAAACTTCCGTGCGACCTTAATTCCGACGATTGCGGTACCAGTGGTCTTGCTGGGAACGTTTGCGATTTTGTCGGCCACGGGCTTCTCTATCAACACCCTTACCATGTTTGCTATGGTGCTGGCGATTGGTCTGTTGGTGGACGACGCCATCGTGGTGGTTGAAAACGTTGAGCGGGTGATGTCGGAAGAAGGGTTGAGCCCACTCGAAGCGACTCGTAAATCGATGGATCAAATCACTGGCGCCTTAGTTGGTATTGGTTTGACGTTATCTGCTGTATTTGTGCCAATGGCATTTATGTCGGGTTCTACTGGGGTCATTTACCGTCAGTTCTCGATCACTATCGTGTCTGCGATGGCATTGTCGGTATTAGTGGCCTTGATTTTAACGCCGGCACTTTGTGCCACTATGTTAAAACCCGTGCAGAAGGGACATGGTCATATTGAAACCGGTTTCTTCGGTTGGTTTAACCGTAACTTTGATCGCTTAACTAACCGTTACGAATCCAGTGTGGCGGGCATAGTGAAGCGTGGCTTTAGAGTCATGATGATTTATGTGGCTTTAGTGGTCGCCGTCGGTTGGATCTTCATGCGTATGCCAACTGCATTCTTACCCGATGAAGACCAAGGTATCTTGTTTACGCAGGCGATTTTGCCAACAAACTCGACTCAAGAAAGTACCCTCAAAGTGCTGGATAAGGTATCCGATCAC
 TTCATGGCTGAAGAAGGCGTGAGATCGGTATTCAGCGTGGCGGGCTTTAGCTTTGCGGGTCAAGGCCAAAACATGGGTATCGCTTTCGTTGGCTTGAAGGATTGGTCAGAGCGTGAAGCACCTGGTATGGATGTGCAGTCTATTGCGGGTCGTGCTATGGGTGCCTTTAGTCAAATTAAAGACGCCTTC!
 GTATTTGCCTTCGTACCACCTGCGGTTATTGAGCTGGGTACGGCGAATGGTTTTGACATGTACCTGCAAG
ATAAAAACGGTCAAGGCCACGATAAGTTAATAGCGGCTCGTAACCAATTGCTGGGTATGGCGGCTCAGAATCCAAACCTTATGGGTGTTCGCCCTAATGGTCAGGAAGATGCGCCAATCTATCAATTGCATATTGATCATGCAAAGTTGAGCGCATTAGGCGTTGATATTGCTAACGTTAACAGTGTGTTGGCAACTGCTTGGGGTGGTTCCTATGTGAACGATTTTATCGACCGCGGCCGTGTGAAAAAGGTATTTGTGCAAGGTGATGCCCAATACCGTATGCAGCCTGAAGACCTCAACACTTGGTACGTGCGTAACAACAAGGGTGACATGGTGCCATTTTCGGCCTTTGCAACAGGTTCTTGGGAATACGGCTCACCGCGTCTAGAACGTTTTAACGGTTTACCAGCGGTGAATATTCAAGGCGCAACTGCACCAGGCTTTAGTACGGGTGCTGCCATGACTATCATGGAGGACTTAGTTAAGCAGCTACCACCTGGCTTTGGCATCGAGTGGAACGGCTTATCCTACGAGGAACGTTTATCGGGTAACCAAGCACCAGCCTTGTATGCGTTGTCGATTCTGGTGGTATTCCTTGTATTAGCAGCCTTGTATGAAAGCTGGTCAGTACCGTTTGCGGTTATCCTTGTGGTTCCATTGGGGATTATCGGTGCTCTATTGGCGATGAATGGTCGAGGCTTGCCTAACGACGTGTTCTTCCAAGTGGGTCTGTTAACAACGGTTGGTTTGGCAACCAAGAACGCCATCTTGATTGTGGAATTTGCAAAAGAATTCTAC
 GAGAAGGGGGCGGGTCTGGTTGAGGCGACCTTACATGCGGTCCGCGTGCGTTTACGTCCGATTTTAATGACGTCGCTCGCTTTTGGTCTGGGGGTTGTACCGCTAGCCATTAGTACAGGTGTGGGTTCGGGCAGTCAGAACGCCATTGGTACCGGTGTACTTGGCGGTATGATGAGTTCGACCTTCTTA!
 GGTATCTTCTTCGTGCCACTGTTCTTCGTCATTGTTGAGCGGATCTTCAGTAAACGAGAGCGAAAAGCGAAAGAGAAAAATCCTACGTCGACGGATTAA

Gmane