Brian Osborne | 13 Feb 03:30 2013
Picon
Picon

Re: Bio::Tools::SeqStats->count_codons

Shyam,

An ambiguous codon would be one that has a character other than [ACTGU] in it. I see '!' in your sequences,
that would create an ambiguous codon.

Brian O.

On Feb 12, 2013, at 4:24 PM, Shyam Saladi <saladi1 <at> illinois.edu> wrote:

> Hi,
> 
> I am using the count_codons method from Bio::Tools::SeqStats and keep
> getting "AMBIGUOUS" codons, but I can't figure out why exactly.
> 
> When I translate the same sequence that gives the error using another
> standard utility like (ExPASy - Translate), it seems to work alright.
> 
> An example sequence is below. Could anyone lend some insight?
> 
> Thanks,
> Shyam
> 
> 
> 
> AAA     AAC     AAG     AAT     ACA     ACC     ACG     ACT     AGA     AGC
>    AGT     *AMBIGUOUS*       ATA     ATC     ATG     ATT     CAA     CAC
>  CAG     CAT     CCA     CCC     CCG     CCT     CGA     CGC     CGG
> CGT     CTA     CTC     CTG     CTT     GAA     GAC     GAG     GAT     GCA
>    GCC     GCG     GCT     GGA     GGC     GGG     GGT     GTA     GTC
> GTG     GTT     TAA     TAC     TAT     TCA     TCC     TCG     TCT     TGG
>    TGT     TTA     TTC     TTG     TTT     count   filename
> 1.722488038277511961722488038277511961722
> 2.966507177033492822966507177033492822967
> 1.531100478468899521531100478468899521531
> 0.9569377990430622009569377990430622009569
> 0.4784688995215311004784688995215311004785
> 1.722488038277511961722488038277511961722
> 1.33971291866028708133971291866028708134
> 1.913875598086124401913875598086124401914
> 0.1913875598086124401913875598086124401914
> 0.7655502392344497607655502392344497607656
> 1.435406698564593301435406698564593301435       *
> 0.09569377990430622009569377990430622009569*
> 0.3827751196172248803827751196172248803828
> 2.488038277511961722488038277511961722488
> 3.349282296650717703349282296650717703349
> 3.636363636363636363636363636363636363636
> 2.870813397129186602870813397129186602871
> 0.3827751196172248803827751196172248803828
> 1.626794258373205741626794258373205741627
> 0.4784688995215311004784688995215311004785
> 1.722488038277511961722488038277511961722
> 0.5741626794258373205741626794258373205742
> 1.052631578947368421052631578947368421053
> 1.244019138755980861244019138755980861244
> 0.3827751196172248803827751196172248803828
> 0.7655502392344497607655502392344497607656
> 0.1913875598086124401913875598086124401914
> 2.488038277511961722488038277511961722488
> 0.4784688995215311004784688995215311004785
> 0.6698564593301435406698564593301435406699
> 2.105263157894736842105263157894736842105
> 0.8612440191387559808612440191387559808612
> 2.870813397129186602870813397129186602871
> 1.435406698564593301435406698564593301435
> 1.722488038277511961722488038277511961722
> 2.775119617224880382775119617224880382775
> 2.00956937799043062200956937799043062201
> 2.488038277511961722488038277511961722488
> 3.540669856459330143540669856459330143541
> 2.00956937799043062200956937799043062201
> 0.1913875598086124401913875598086124401914
> 2.392344497607655502392344497607655502392
> 0.8612440191387559808612440191387559808612
> 5.454545454545454545454545454545454545455
> 1.913875598086124401913875598086124401914
> 0.8612440191387559808612440191387559808612
> 4.593301435406698564593301435406698564593
> 2.679425837320574162679425837320574162679
> 0.09569377990430622009569377990430622009569
> 1.148325358851674641148325358851674641148
> 1.148325358851674641148325358851674641148
> 0.8612440191387559808612440191387559808612
> 0.4784688995215311004784688995215311004785
> 2.105263157894736842105263157894736842105
> 0.9569377990430622009569377990430622009569
> 0.9569377990430622009569377990430622009569
> 0.09569377990430622009569377990430622009569
> 2.679425837320574162679425837320574162679
> 2.966507177033492822966507177033492822967
> 3.062200956937799043062200956937799043062
> 2.775119617224880382775119617224880382775       1045    temp.seq
> 
> ATGGCACGTTTTTTTATTGATCGTCCCATCTTTGCGTGGGTGATCGCCTTAATTATTATGTTGGCGGGGGTGCTTTCAATTCGCACCCTGCCGGTTTCTCAATATCCCAGCATTGCACCGCCAACCGTGGTGATCAGTGCTAACTACCCTGGTGCATCGGCCAAGATTGTTGAAGACTCAGTGACTCAGGTGATTGAGCAACGCATGAAGGGTATCGATCACCTACGTTATATTGCCTCAACCAGCGATAGTTTCGGTAATGCTGAAATCACTTTGACCTTCAATGCCGAAGCCGATCCTGATATTGCTCAGGTACAAGTTCAGAACAAATTGCAGGGTGCAATGACCCTGTTACCACAAGAGGTACAGGCTCAAGGGGTTGACGTTAACAAATCAAGTTCTGGCTTYTTGATGGTGCTGGGTTTCGTATCGACTGACGGTTCCTTAGATAAAGGCGACATCGCCGACTATGTGGGTGCAAACGTACAAGATCCCATGAGCCGTGTACCGGGCGTGGGTGAAATTCAGCTGTTTGGTGCCCAATATGCGATGCGTATATGGCTTGATCCTTTAAAACTGACTCAATATAACTTGACCAGTTTAGAGGTGATCTCGGCGATTCGTGCTCAAAACGCGCAGGTGTCTGCGGGTCAGTTGGGTGGTACGCCGTCAATTCAAGGGCAAGAACTTAACGCCACTGTTTCGGCGCAAAGTCGTTTGCAAACCCCTGAAGAGTTTCGCAAGATTATCCTGAAGTCTGATACTTCGGGTGCGAATGTGTTCCTCGGTGATGTGGCG
 CGCGTAGAGTTAGGTTCAGAGAGTTATGCCGTTGTCTCGTTCTACAATGGTAAGCCTGCTACTGGTTTAGCGATTAAACTGGCGACAGGCGCAAACGCGTTGGATACCGCTGAAGCTGTTCGTGATAAAGTTGAAGAATTGCGACCTTTCTTCCCGCAAGGGTTGGATGTTGTTTATCCCTACGATACT!
 AC!
> GCCATTCGTTGAGAAATCGATAGAAGGCGTGGTACACACCCTGCTCGAAGCGATTGTTCTGGTGTTTGTCATCATGTACCTCTTCCTGCAAAACTTCCGTGCGACCTTAATTCCGACGATTGCGGTACCAGTGGTCTTGCTGGGAACGTTTGCGATTTTGTCGGCCACGGGCTTCTCTATCAACACCCTTACCATGTTTGCTATGGTGCTGGCGATTGGTCTGTTGGTGGACGACGCCATCGTGGTGGTTGAAAACGTTGAGCGGGTGATGTCGGAAGAAGGGTTGAGCCCACTCGAAGCGACTCGTAAATCGATGGATCAAATCACTGGCGCCTTAGTTGGTATTGGTTTGACGTTATCTGCTGTATTTGTGCCAATGGCATTTATGTCGGGTTCTACTGGGGTCATTTACCGTCAGTTCTCGATCACTATCGTGTCTGCGATGGCATTGTCGGTATTAGTGGCCTTGATTTTAACGCCGGCACTTTGTGCCACTATGTTAAAACCCGTGCAGAAGGGACATGGTCATATTGAAACCGGTTTCTTCGGTTGGTTTAACCGTAACTTTGATCGCTTAACTAACCGTTACGAATCCAGTGTGGCGGGCATAGTGAAGCGTGGCTTTAGAGTCATGATGATTTATGTGGCTTTAGTGGTCGCCGTCGGTTGGATCTTCATGCGTATGCCAACTGCATTCTTACCCGATGAAGACCAAGGTATCTTGTTTACGCAGGCGATTTTGCCAACAAACTCGACTCAAGAAAGTACCCTCAAAGTGCTGGATAAGGTATCCGATCA
 CTTCATGGCTGAAGAAGGCGTGAGATCGGTATTCAGCGTGGCGGGCTTTAGCTTTGCGGGTCAAGGCCAAAACATGGGTATCGCTTTCGTTGGCTTGAAGGATTGGTCAGAGCGTGAAGCACCTGGTATGGATGTGCAGTCTATTGCGGGTCGTGCTATGGGTGCCTTTAGTCAAATTAAAGACGCCTT!
 C!
> GTATTTGCCTTCGTACCACCTGCGGTTATTGAGCTGGGTACGGCGAATGGTTTTGACATGTACCTGCAAG
> ATAAAAACGGTCAAGGCCACGATAAGTTAATAGCGGCTCGTAACCAATTGCTGGGTATGGCGGCTCAGAATCCAAACCTTATGGGTGTTCGCCCTAATGGTCAGGAAGATGCGCCAATCTATCAATTGCATATTGATCATGCAAAGTTGAGCGCATTAGGCGTTGATATTGCTAACGTTAACAGTGTGTTGGCAACTGCTTGGGGTGGTTCCTATGTGAACGATTTTATCGACCGCGGCCGTGTGAAAAAGGTATTTGTGCAAGGTGATGCCCAATACCGTATGCAGCCTGAAGACCTCAACACTTGGTACGTGCGTAACAACAAGGGTGACATGGTGCCATTTTCGGCCTTTGCAACAGGTTCTTGGGAATACGGCTCACCGCGTCTAGAACGTTTTAACGGTTTACCAGCGGTGAATATTCAAGGCGCAACTGCACCAGGCTTTAGTACGGGTGCTGCCATGACTATCATGGAGGACTTAGTTAAGCAGCTACCACCTGGCTTTGGCATCGAGTGGAACGGCTTATCCTACGAGGAACGTTTATCGGGTAACCAAGCACCAGCCTTGTATGCGTTGTCGATTCTGGTGGTATTCCTTGTATTAGCAGCCTTGTATGAAAGCTGGTCAGTACCGTTTGCGGTTATCCTTGTGGTTCCATTGGGGATTATCGGTGCTCTATTGGCGATGAATGGTCGAGGCTTGCCTAACGACGTGTTCTTCCAAGTGGGTCTGTTAACAACGGTTGGTTTGGCAACCAAGAACGCCATCTTGATTGTGGAATTTGCAAAAGAATTCT
 ACGAGAAGGGGGCGGGTCTGGTTGAGGCGACCTTACATGCGGTCCGCGTGCGTTTACGTCCGATTTTAATGACGTCGCTCGCTTTTGGTCTGGGGGTTGTACCGCTAGCCATTAGTACAGGTGTGGGTTCGGGCAGTCAGAACGCCATTGGTACCGGTGTACTTGGCGGTATGATGAGTTCGACCTTCT!
 TA!
> GGTATCTTCTTCGTGCCACTGTTCTTCGTCATTGTTGAGCGGATCTTCAGTAAACGAGAGCGAAAAGCGAAAGAGAAAAATCCTACGTCGACGGATTAA
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l <at> lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Gmane