Franklin Johnson [guest] | 7 Oct 23:31 2012

coefs<-getAffinitySplineCoefficients...design error message help


Dear Help,

After loading the pd.Citrus library and checking the DataFrame, I ran
> the R code for:
1) 'oligo'

> {> library(pd.citrus)
> Loading required package: RSQLite
> Loading required package: DBI
> > data(pmSequence)
> 
> > show(pmSequence)
> DataFrame with 341730 rows and 2 columns
> fid sequence
> <integer> <DNAStringSet>
> 1 990 GCTTTTGGAACGATGGCGATGGCTA
> 2 991 CGACGGGTTGCCTTCGGAGCTAAAT
> 3 992 TACTGCAGAAGACCATTACCCTACA
> 4 993 TCACATAGCTGTGCAAGGACCGTAT
> 5 994 TCGCCTAGCAAAGCTGCCAGCATGT
> 6 995 TTACGTCTACGTGGTGGTGCTAAGA
> 7 996 CCGAACGACCTGTTGGACCAAAGCA
> 8 999 AAGCTAGTCTAGCTCCACCGACGGC
> 9 1000 TTTTCACCGGTGACGTGCCGGTCGC
> ... ... ...
> 341722 963599 AAATTCGACATTTTCTTTACTGAGA
> 341723 963790 GGATGCCCTCCGGTAATTGAATCAT
> 341724 963802 GTTCAGCTCAAACCCTACATAGAGA
> 341725 963818 GGAAAAATGTCTCAACCAGCTGGTT
> 341726 963841 GAGAAGATGTTCAGAGGGCCCTACA
> 341727 963859 GGTGCAGTTCGACTCTAAGTTTGCT
> 341728 963863 AAACACGGTTATTCATCTGCGAAAC
> 341729 963874 GATGCTCTTCATTGGGAGGCAGCGA
> 341730 963889 ATTGATACAGCCTTCTCTGCAGTAA
> > getwd()
> [1] "C:/Users/franklin.johnson.PW50-WEN/Desktop/GSE33964_citrus epi
> cells/exData"}
> 
> {library(oligo)
> > celFiles<-list.celfiles("exData", full.names=TRUE)
> > affyCit<-read.celfiles("GSM839728_GF_28mm_EC-1.CEL",
> "GSM839729_GF_28mm_EC-2.CEL", "GSM839730_GF_28mm_EC-3.CEL",
> "GSM839731_GF_28mm_PC-1.CEL", "GSM839732_GF_28mm_PC-2.CEL",
> "GSM839733_GF_28mm_PC-3.CEL", "GSM839734_GF_41mm_EC-1.CEL",
> "GSM839735_GF_41mm_EC-2.CEL", "GSM839736_GF_41mm_EC-3.CEL",
> "GSM839737_GF_41mm_PC-1.CEL", "GSM839738_GF_41mm_PC-2.CEL",
> "GSM839739_GF_41mm_PC-3.CEL", pkgname="pd.citrus")
> Platform design info loaded.
> Reading in : GSM839728_GF_28mm_EC-1.CEL
> Reading in : GSM839729_GF_28mm_EC-2.CEL
> Reading in : GSM839730_GF_28mm_EC-3.CEL
> Reading in : GSM839731_GF_28mm_PC-1.CEL
> Reading in : GSM839732_GF_28mm_PC-2.CEL
> Reading in : GSM839733_GF_28mm_PC-3.CEL
> Reading in : GSM839734_GF_41mm_EC-1.CEL
> Reading in : GSM839735_GF_41mm_EC-2.CEL
> Reading in : GSM839736_GF_41mm_EC-3.CEL
> Reading in : GSM839737_GF_41mm_PC-1.CEL
> Reading in : GSM839738_GF_41mm_PC-2.CEL
> Reading in : GSM839739_GF_41mm_PC-3.CEL
> > pmSeq<-pmSequence(affyCit)
> > pmSeq[1:10]
> A DNAStringSet instance of length 10
> width seq
> [1] 25 GCTTTTGGAACGATGGCGATGGCTA
> [2] 25 CGACGGGTTGCCTTCGGAGCTAAAT
> [3] 25 TACTGCAGAAGACCATTACCCTACA
> [4] 25 TCACATAGCTGTGCAAGGACCGTAT
> [5] 25 TCGCCTAGCAAAGCTGCCAGCATGT
> [6] 25 TTACGTCTACGTGGTGGTGCTAAGA
> [7] 25 CCGAACGACCTGTTGGACCAAAGCA
> [8] 25 AAGCTAGTCTAGCTCCACCGACGGC
> [9] 25 TTTTCACCGGTGACGTGCCGGTCGC
> [10] 25 GGTTAAGCCCGGCACTATCCGGGCA
> > pmsLog2<-log2(pm(affyCit))
> > plot(pmsLog2) #the plots looks good across arrays (object=affyCit) 
> 
> However, still get:
> coefs<-getAffinitySplineCoefficients(pmsLog2, pmSeq)
> Error in model.frame.default(formula = intensities ~ design,
> drop.unused.levels = TRUE) : 
> variable lengths differ (found for 'design')

I have been working on the issue for two weeks already.
For example, above I loaded the Citrus.pd, additionally, I tried working with library(citruscdf),
although this did not work either?
Moreover, I used R 2.6 with the devel 'affyio' package version 1.27.1, but cannot run 'oligo' with R 2.6 for
some reason (i.e. error in list.celFiles and read.celfiles commands), although R version for 'oligo' is
2.15 or greater, so cannot use the list matrix generated in 'affyio' version 1.27 on R 2.6 cause is does not
seem compatible with 'oligo' version 1.22 on R 2.6. I am also using the recently updated BioC version 2.11.  
In oligo using R v. 2.15, I am able to view the .CEL images, make boxplots, MAplots of the data, but cannot
proceed beyond this point (as indicated above). 

In summary, is this a bug in the 'oligo' package??

Any assistance is greatly appreciated.
If you have questions or need additional information, please feel free to contact me.

Best Regards,

Franklin 

 -- output of sessionInfo(): 

> sessionInfo()
R version 2.15.1 (2012-06-22)
Platform: i386-pc-mingw32/i386 (32-bit)
locale:
[1] LC_COLLATE=English_United States.1252 
[2] LC_CTYPE=English_United States.1252   
[3] LC_MONETARY=English_United States.1252
[4] LC_NUMERIC=C                          
[5] LC_TIME=English_United States.1252    
attached base packages:
[1] stats     graphics  grDevices utils     datasets  methods   base     
other attached packages:
[1] oligo_1.22.0        Biobase_2.18.0      oligoClasses_1.20.0
[4] BiocInstaller_1.8.1 BiocGenerics_0.4.0 
loaded via a namespace (and not attached):
 [1] affxparser_1.30.0     affyio_1.26.0         Biostrings_2.26.1    
 [4] bit_1.1-8             codetools_0.2-8       DBI_0.2-5            
 [7] ff_2.2-7              foreach_1.4.0         GenomicRanges_1.10.1 
[10] IRanges_1.16.2        iterators_1.0.6       parallel_2.15.1      
[13] preprocessCore_1.20.0 splines_2.15.1        stats4_2.15.1        
[16] tools_2.15.1          zlibbioc_1.4.0       

--
Sent via the guest posting facility at bioconductor.org.

_______________________________________________
Bioconductor mailing list
Bioconductor@...
https://stat.ethz.ch/mailman/listinfo/bioconductor
Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor


Gmane