8 Oct 2012 14:34
Re: coefs<-getAffinitySplineCoefficients...design error message help
Franklin, I'm currently away. Please hold tight and I'll get back to you as soon as I get to a computer. benilton -- Sent from a mobile device. On Oct 7, 2012 10:33 PM, "Franklin Johnson [guest]" <guest@...> wrote: > > Dear Help, > > After loading the pd.Citrus library and checking the DataFrame, I ran > > the R code for: > 1) 'oligo' > > > {> library(pd.citrus) > > Loading required package: RSQLite > > Loading required package: DBI > > > data(pmSequence) > > > > > show(pmSequence) > > DataFrame with 341730 rows and 2 columns > > fid sequence > > <integer> <DNAStringSet> > > 1 990 GCTTTTGGAACGATGGCGATGGCTA > > 2 991 CGACGGGTTGCCTTCGGAGCTAAAT > > 3 992 TACTGCAGAAGACCATTACCCTACA > > 4 993 TCACATAGCTGTGCAAGGACCGTAT > > 5 994 TCGCCTAGCAAAGCTGCCAGCATGT > > 6 995 TTACGTCTACGTGGTGGTGCTAAGA > > 7 996 CCGAACGACCTGTTGGACCAAAGCA > > 8 999 AAGCTAGTCTAGCTCCACCGACGGC > > 9 1000 TTTTCACCGGTGACGTGCCGGTCGC > > ... ... ... > > 341722 963599 AAATTCGACATTTTCTTTACTGAGA > > 341723 963790 GGATGCCCTCCGGTAATTGAATCAT > > 341724 963802 GTTCAGCTCAAACCCTACATAGAGA > > 341725 963818 GGAAAAATGTCTCAACCAGCTGGTT > > 341726 963841 GAGAAGATGTTCAGAGGGCCCTACA > > 341727 963859 GGTGCAGTTCGACTCTAAGTTTGCT > > 341728 963863 AAACACGGTTATTCATCTGCGAAAC > > 341729 963874 GATGCTCTTCATTGGGAGGCAGCGA > > 341730 963889 ATTGATACAGCCTTCTCTGCAGTAA > > > getwd() > > [1] "C:/Users/franklin.johnson.PW50-WEN/Desktop/GSE33964_citrus epi > > cells/exData"} > > > > {library(oligo) > > > celFiles<-list.celfiles("exData", full.names=TRUE) > > > affyCit<-read.celfiles("GSM839728_GF_28mm_EC-1.CEL", > > "GSM839729_GF_28mm_EC-2.CEL", "GSM839730_GF_28mm_EC-3.CEL", > > "GSM839731_GF_28mm_PC-1.CEL", "GSM839732_GF_28mm_PC-2.CEL", > > "GSM839733_GF_28mm_PC-3.CEL", "GSM839734_GF_41mm_EC-1.CEL", > > "GSM839735_GF_41mm_EC-2.CEL", "GSM839736_GF_41mm_EC-3.CEL", > > "GSM839737_GF_41mm_PC-1.CEL", "GSM839738_GF_41mm_PC-2.CEL", > > "GSM839739_GF_41mm_PC-3.CEL", pkgname="pd.citrus") > > Platform design info loaded. > > Reading in : GSM839728_GF_28mm_EC-1.CEL > > Reading in : GSM839729_GF_28mm_EC-2.CEL > > Reading in : GSM839730_GF_28mm_EC-3.CEL > > Reading in : GSM839731_GF_28mm_PC-1.CEL > > Reading in : GSM839732_GF_28mm_PC-2.CEL > > Reading in : GSM839733_GF_28mm_PC-3.CEL > > Reading in : GSM839734_GF_41mm_EC-1.CEL > > Reading in : GSM839735_GF_41mm_EC-2.CEL > > Reading in : GSM839736_GF_41mm_EC-3.CEL > > Reading in : GSM839737_GF_41mm_PC-1.CEL > > Reading in : GSM839738_GF_41mm_PC-2.CEL > > Reading in : GSM839739_GF_41mm_PC-3.CEL > > > pmSeq<-pmSequence(affyCit) > > > pmSeq[1:10] > > A DNAStringSet instance of length 10 > > width seq > > [1] 25 GCTTTTGGAACGATGGCGATGGCTA > > [2] 25 CGACGGGTTGCCTTCGGAGCTAAAT > > [3] 25 TACTGCAGAAGACCATTACCCTACA > > [4] 25 TCACATAGCTGTGCAAGGACCGTAT > > [5] 25 TCGCCTAGCAAAGCTGCCAGCATGT > > [6] 25 TTACGTCTACGTGGTGGTGCTAAGA > > [7] 25 CCGAACGACCTGTTGGACCAAAGCA > > [8] 25 AAGCTAGTCTAGCTCCACCGACGGC > > [9] 25 TTTTCACCGGTGACGTGCCGGTCGC > > [10] 25 GGTTAAGCCCGGCACTATCCGGGCA > > > pmsLog2<-log2(pm(affyCit)) > > > plot(pmsLog2) #the plots looks good across arrays (object=affyCit) > > > > However, still get: > > coefs<-getAffinitySplineCoefficients(pmsLog2, pmSeq) > > Error in model.frame.default(formula = intensities ~ design, > > drop.unused.levels = TRUE) : > > variable lengths differ (found for 'design') > > I have been working on the issue for two weeks already. > For example, above I loaded the Citrus.pd, additionally, I tried working > with library(citruscdf), although this did not work either? > Moreover, I used R 2.6 with the devel 'affyio' package version 1.27.1, but > cannot run 'oligo' with R 2.6 for some reason (i.e. error in list.celFiles > and read.celfiles commands), although R version for 'oligo' is 2.15 or > greater, so cannot use the list matrix generated in 'affyio' version 1.27 > on R 2.6 cause is does not seem compatible with 'oligo' version 1.22 on R > 2.6. I am also using the recently updated BioC version 2.11. > In oligo using R v. 2.15, I am able to view the .CEL images, make > boxplots, MAplots of the data, but cannot proceed beyond this point (as > indicated above). > > In summary, is this a bug in the 'oligo' package?? > > Any assistance is greatly appreciated. > If you have questions or need additional information, please feel free to > contact me. > > Best Regards, > > Franklin > > -- output of sessionInfo(): > > > > sessionInfo() > R version 2.15.1 (2012-06-22) > Platform: i386-pc-mingw32/i386 (32-bit) > locale: > [1] LC_COLLATE=English_United States.1252 > [2] LC_CTYPE=English_United States.1252 > [3] LC_MONETARY=English_United States.1252 > [4] LC_NUMERIC=C > [5] LC_TIME=English_United States.1252 > attached base packages: > [1] stats graphics grDevices utils datasets methods base > other attached packages: > [1] oligo_1.22.0 Biobase_2.18.0 oligoClasses_1.20.0 > [4] BiocInstaller_1.8.1 BiocGenerics_0.4.0 > loaded via a namespace (and not attached): > [1] affxparser_1.30.0 affyio_1.26.0 Biostrings_2.26.1 > [4] bit_1.1-8 codetools_0.2-8 DBI_0.2-5 > [7] ff_2.2-7 foreach_1.4.0 GenomicRanges_1.10.1 > [10] IRanges_1.16.2 iterators_1.0.6 parallel_2.15.1 > [13] preprocessCore_1.20.0 splines_2.15.1 stats4_2.15.1 > [16] tools_2.15.1 zlibbioc_1.4.0 > > > > -- > Sent via the guest posting facility at bioconductor.org. > > _______________________________________________ > Bioconductor mailing list > Bioconductor@... > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > [[alternative HTML version deleted]] _______________________________________________ Bioconductor mailing list Bioconductor@... https://stat.ethz.ch/mailman/listinfo/bioconductor Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor
RSS Feed