Benilton Carvalho | 8 Oct 14:34 2012
Picon

Re: coefs<-getAffinitySplineCoefficients...design error message help

Franklin, I'm currently away. Please hold tight and I'll get back to you as
soon as I get to a computer.
benilton

--
Sent from a mobile device.
On Oct 7, 2012 10:33 PM, "Franklin Johnson [guest]" <guest@...>
wrote:

>
> Dear Help,
>
> After loading the pd.Citrus library and checking the DataFrame, I ran
> > the R code for:
> 1) 'oligo'
>
> > {> library(pd.citrus)
> > Loading required package: RSQLite
> > Loading required package: DBI
> > > data(pmSequence)
> >
> > > show(pmSequence)
> > DataFrame with 341730 rows and 2 columns
> > fid sequence
> > <integer> <DNAStringSet>
> > 1 990 GCTTTTGGAACGATGGCGATGGCTA
> > 2 991 CGACGGGTTGCCTTCGGAGCTAAAT
> > 3 992 TACTGCAGAAGACCATTACCCTACA
> > 4 993 TCACATAGCTGTGCAAGGACCGTAT
> > 5 994 TCGCCTAGCAAAGCTGCCAGCATGT
> > 6 995 TTACGTCTACGTGGTGGTGCTAAGA
> > 7 996 CCGAACGACCTGTTGGACCAAAGCA
> > 8 999 AAGCTAGTCTAGCTCCACCGACGGC
> > 9 1000 TTTTCACCGGTGACGTGCCGGTCGC
> > ... ... ...
> > 341722 963599 AAATTCGACATTTTCTTTACTGAGA
> > 341723 963790 GGATGCCCTCCGGTAATTGAATCAT
> > 341724 963802 GTTCAGCTCAAACCCTACATAGAGA
> > 341725 963818 GGAAAAATGTCTCAACCAGCTGGTT
> > 341726 963841 GAGAAGATGTTCAGAGGGCCCTACA
> > 341727 963859 GGTGCAGTTCGACTCTAAGTTTGCT
> > 341728 963863 AAACACGGTTATTCATCTGCGAAAC
> > 341729 963874 GATGCTCTTCATTGGGAGGCAGCGA
> > 341730 963889 ATTGATACAGCCTTCTCTGCAGTAA
> > > getwd()
> > [1] "C:/Users/franklin.johnson.PW50-WEN/Desktop/GSE33964_citrus epi
> > cells/exData"}
> >
> > {library(oligo)
> > > celFiles<-list.celfiles("exData", full.names=TRUE)
> > > affyCit<-read.celfiles("GSM839728_GF_28mm_EC-1.CEL",
> > "GSM839729_GF_28mm_EC-2.CEL", "GSM839730_GF_28mm_EC-3.CEL",
> > "GSM839731_GF_28mm_PC-1.CEL", "GSM839732_GF_28mm_PC-2.CEL",
> > "GSM839733_GF_28mm_PC-3.CEL", "GSM839734_GF_41mm_EC-1.CEL",
> > "GSM839735_GF_41mm_EC-2.CEL", "GSM839736_GF_41mm_EC-3.CEL",
> > "GSM839737_GF_41mm_PC-1.CEL", "GSM839738_GF_41mm_PC-2.CEL",
> > "GSM839739_GF_41mm_PC-3.CEL", pkgname="pd.citrus")
> > Platform design info loaded.
> > Reading in : GSM839728_GF_28mm_EC-1.CEL
> > Reading in : GSM839729_GF_28mm_EC-2.CEL
> > Reading in : GSM839730_GF_28mm_EC-3.CEL
> > Reading in : GSM839731_GF_28mm_PC-1.CEL
> > Reading in : GSM839732_GF_28mm_PC-2.CEL
> > Reading in : GSM839733_GF_28mm_PC-3.CEL
> > Reading in : GSM839734_GF_41mm_EC-1.CEL
> > Reading in : GSM839735_GF_41mm_EC-2.CEL
> > Reading in : GSM839736_GF_41mm_EC-3.CEL
> > Reading in : GSM839737_GF_41mm_PC-1.CEL
> > Reading in : GSM839738_GF_41mm_PC-2.CEL
> > Reading in : GSM839739_GF_41mm_PC-3.CEL
> > > pmSeq<-pmSequence(affyCit)
> > > pmSeq[1:10]
> > A DNAStringSet instance of length 10
> > width seq
> > [1] 25 GCTTTTGGAACGATGGCGATGGCTA
> > [2] 25 CGACGGGTTGCCTTCGGAGCTAAAT
> > [3] 25 TACTGCAGAAGACCATTACCCTACA
> > [4] 25 TCACATAGCTGTGCAAGGACCGTAT
> > [5] 25 TCGCCTAGCAAAGCTGCCAGCATGT
> > [6] 25 TTACGTCTACGTGGTGGTGCTAAGA
> > [7] 25 CCGAACGACCTGTTGGACCAAAGCA
> > [8] 25 AAGCTAGTCTAGCTCCACCGACGGC
> > [9] 25 TTTTCACCGGTGACGTGCCGGTCGC
> > [10] 25 GGTTAAGCCCGGCACTATCCGGGCA
> > > pmsLog2<-log2(pm(affyCit))
> > > plot(pmsLog2) #the plots looks good across arrays (object=affyCit)
> >
> > However, still get:
> > coefs<-getAffinitySplineCoefficients(pmsLog2, pmSeq)
> > Error in model.frame.default(formula = intensities ~ design,
> > drop.unused.levels = TRUE) :
> > variable lengths differ (found for 'design')
>
> I have been working on the issue for two weeks already.
> For example, above I loaded the Citrus.pd, additionally, I tried working
> with library(citruscdf), although this did not work either?
> Moreover, I used R 2.6 with the devel 'affyio' package version 1.27.1, but
> cannot run 'oligo' with R 2.6 for some reason (i.e. error in list.celFiles
> and read.celfiles commands), although R version for 'oligo' is 2.15 or
> greater, so cannot use the list matrix generated in 'affyio' version 1.27
> on R 2.6 cause is does not seem compatible with 'oligo' version 1.22 on R
> 2.6. I am also using the recently updated BioC version 2.11.
> In oligo using R v. 2.15, I am able to view the .CEL images, make
> boxplots, MAplots of the data, but cannot proceed beyond this point (as
> indicated above).
>
> In summary, is this a bug in the 'oligo' package??
>
> Any assistance is greatly appreciated.
> If you have questions or need additional information, please feel free to
> contact me.
>
> Best Regards,
>
> Franklin
>
>  -- output of sessionInfo():
>
>
> > sessionInfo()
> R version 2.15.1 (2012-06-22)
> Platform: i386-pc-mingw32/i386 (32-bit)
> locale:
> [1] LC_COLLATE=English_United States.1252
> [2] LC_CTYPE=English_United States.1252
> [3] LC_MONETARY=English_United States.1252
> [4] LC_NUMERIC=C
> [5] LC_TIME=English_United States.1252
> attached base packages:
> [1] stats     graphics  grDevices utils     datasets  methods   base
> other attached packages:
> [1] oligo_1.22.0        Biobase_2.18.0      oligoClasses_1.20.0
> [4] BiocInstaller_1.8.1 BiocGenerics_0.4.0
> loaded via a namespace (and not attached):
>  [1] affxparser_1.30.0     affyio_1.26.0         Biostrings_2.26.1
>  [4] bit_1.1-8             codetools_0.2-8       DBI_0.2-5
>  [7] ff_2.2-7              foreach_1.4.0         GenomicRanges_1.10.1
> [10] IRanges_1.16.2        iterators_1.0.6       parallel_2.15.1
> [13] preprocessCore_1.20.0 splines_2.15.1        stats4_2.15.1
> [16] tools_2.15.1          zlibbioc_1.4.0
>
>
>
> --
> Sent via the guest posting facility at bioconductor.org.
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor@...
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives:
> http://news.gmane.org/gmane.science.biology.informatics.conductor
>

	[[alternative HTML version deleted]]

_______________________________________________
Bioconductor mailing list
Bioconductor@...
https://stat.ethz.ch/mailman/listinfo/bioconductor
Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor


Gmane