Benilton Carvalho | 9 Oct 23:34 2012
Picon

Re: coefs<-getAffinitySplineCoefficients...design error message help

Dear Franklin,

I identified that the probe sequences for about 2K probes (whose
probenames are always RandomGCXY_at) are not given in the annotation
files and that's why you're running into this problem.

I need to check with Affymetrix for the proper sequence files (maybe
the sequences are available through a different strategy that I failed
to notice).

Apologies for the inconvenience,
benilton

On 8 October 2012 13:34, Benilton Carvalho
<beniltoncarvalho@...> wrote:
> Franklin, I'm currently away. Please hold tight and I'll get back to you as
> soon as I get to a computer.
> benilton
>
> --
> Sent from a mobile device.
>
> On Oct 7, 2012 10:33 PM, "Franklin Johnson [guest]" <guest@...>
> wrote:
>>
>>
>> Dear Help,
>>
>> After loading the pd.Citrus library and checking the DataFrame, I ran
>> > the R code for:
>> 1) 'oligo'
>>
>> > {> library(pd.citrus)
>> > Loading required package: RSQLite
>> > Loading required package: DBI
>> > > data(pmSequence)
>> >
>> > > show(pmSequence)
>> > DataFrame with 341730 rows and 2 columns
>> > fid sequence
>> > <integer> <DNAStringSet>
>> > 1 990 GCTTTTGGAACGATGGCGATGGCTA
>> > 2 991 CGACGGGTTGCCTTCGGAGCTAAAT
>> > 3 992 TACTGCAGAAGACCATTACCCTACA
>> > 4 993 TCACATAGCTGTGCAAGGACCGTAT
>> > 5 994 TCGCCTAGCAAAGCTGCCAGCATGT
>> > 6 995 TTACGTCTACGTGGTGGTGCTAAGA
>> > 7 996 CCGAACGACCTGTTGGACCAAAGCA
>> > 8 999 AAGCTAGTCTAGCTCCACCGACGGC
>> > 9 1000 TTTTCACCGGTGACGTGCCGGTCGC
>> > ... ... ...
>> > 341722 963599 AAATTCGACATTTTCTTTACTGAGA
>> > 341723 963790 GGATGCCCTCCGGTAATTGAATCAT
>> > 341724 963802 GTTCAGCTCAAACCCTACATAGAGA
>> > 341725 963818 GGAAAAATGTCTCAACCAGCTGGTT
>> > 341726 963841 GAGAAGATGTTCAGAGGGCCCTACA
>> > 341727 963859 GGTGCAGTTCGACTCTAAGTTTGCT
>> > 341728 963863 AAACACGGTTATTCATCTGCGAAAC
>> > 341729 963874 GATGCTCTTCATTGGGAGGCAGCGA
>> > 341730 963889 ATTGATACAGCCTTCTCTGCAGTAA
>> > > getwd()
>> > [1] "C:/Users/franklin.johnson.PW50-WEN/Desktop/GSE33964_citrus epi
>> > cells/exData"}
>> >
>> > {library(oligo)
>> > > celFiles<-list.celfiles("exData", full.names=TRUE)
>> > > affyCit<-read.celfiles("GSM839728_GF_28mm_EC-1.CEL",
>> > "GSM839729_GF_28mm_EC-2.CEL", "GSM839730_GF_28mm_EC-3.CEL",
>> > "GSM839731_GF_28mm_PC-1.CEL", "GSM839732_GF_28mm_PC-2.CEL",
>> > "GSM839733_GF_28mm_PC-3.CEL", "GSM839734_GF_41mm_EC-1.CEL",
>> > "GSM839735_GF_41mm_EC-2.CEL", "GSM839736_GF_41mm_EC-3.CEL",
>> > "GSM839737_GF_41mm_PC-1.CEL", "GSM839738_GF_41mm_PC-2.CEL",
>> > "GSM839739_GF_41mm_PC-3.CEL", pkgname="pd.citrus")
>> > Platform design info loaded.
>> > Reading in : GSM839728_GF_28mm_EC-1.CEL
>> > Reading in : GSM839729_GF_28mm_EC-2.CEL
>> > Reading in : GSM839730_GF_28mm_EC-3.CEL
>> > Reading in : GSM839731_GF_28mm_PC-1.CEL
>> > Reading in : GSM839732_GF_28mm_PC-2.CEL
>> > Reading in : GSM839733_GF_28mm_PC-3.CEL
>> > Reading in : GSM839734_GF_41mm_EC-1.CEL
>> > Reading in : GSM839735_GF_41mm_EC-2.CEL
>> > Reading in : GSM839736_GF_41mm_EC-3.CEL
>> > Reading in : GSM839737_GF_41mm_PC-1.CEL
>> > Reading in : GSM839738_GF_41mm_PC-2.CEL
>> > Reading in : GSM839739_GF_41mm_PC-3.CEL
>> > > pmSeq<-pmSequence(affyCit)
>> > > pmSeq[1:10]
>> > A DNAStringSet instance of length 10
>> > width seq
>> > [1] 25 GCTTTTGGAACGATGGCGATGGCTA
>> > [2] 25 CGACGGGTTGCCTTCGGAGCTAAAT
>> > [3] 25 TACTGCAGAAGACCATTACCCTACA
>> > [4] 25 TCACATAGCTGTGCAAGGACCGTAT
>> > [5] 25 TCGCCTAGCAAAGCTGCCAGCATGT
>> > [6] 25 TTACGTCTACGTGGTGGTGCTAAGA
>> > [7] 25 CCGAACGACCTGTTGGACCAAAGCA
>> > [8] 25 AAGCTAGTCTAGCTCCACCGACGGC
>> > [9] 25 TTTTCACCGGTGACGTGCCGGTCGC
>> > [10] 25 GGTTAAGCCCGGCACTATCCGGGCA
>> > > pmsLog2<-log2(pm(affyCit))
>> > > plot(pmsLog2) #the plots looks good across arrays (object=affyCit)
>> >
>> > However, still get:
>> > coefs<-getAffinitySplineCoefficients(pmsLog2, pmSeq)
>> > Error in model.frame.default(formula = intensities ~ design,
>> > drop.unused.levels = TRUE) :
>> > variable lengths differ (found for 'design')
>>
>> I have been working on the issue for two weeks already.
>> For example, above I loaded the Citrus.pd, additionally, I tried working
>> with library(citruscdf), although this did not work either?
>> Moreover, I used R 2.6 with the devel 'affyio' package version 1.27.1, but
>> cannot run 'oligo' with R 2.6 for some reason (i.e. error in list.celFiles
>> and read.celfiles commands), although R version for 'oligo' is 2.15 or
>> greater, so cannot use the list matrix generated in 'affyio' version 1.27 on
>> R 2.6 cause is does not seem compatible with 'oligo' version 1.22 on R 2.6.
>> I am also using the recently updated BioC version 2.11.
>> In oligo using R v. 2.15, I am able to view the .CEL images, make
>> boxplots, MAplots of the data, but cannot proceed beyond this point (as
>> indicated above).
>>
>> In summary, is this a bug in the 'oligo' package??
>>
>> Any assistance is greatly appreciated.
>> If you have questions or need additional information, please feel free to
>> contact me.
>>
>> Best Regards,
>>
>> Franklin
>>
>>  -- output of sessionInfo():
>>
>>
>> > sessionInfo()
>> R version 2.15.1 (2012-06-22)
>> Platform: i386-pc-mingw32/i386 (32-bit)
>> locale:
>> [1] LC_COLLATE=English_United States.1252
>> [2] LC_CTYPE=English_United States.1252
>> [3] LC_MONETARY=English_United States.1252
>> [4] LC_NUMERIC=C
>> [5] LC_TIME=English_United States.1252
>> attached base packages:
>> [1] stats     graphics  grDevices utils     datasets  methods   base
>> other attached packages:
>> [1] oligo_1.22.0        Biobase_2.18.0      oligoClasses_1.20.0
>> [4] BiocInstaller_1.8.1 BiocGenerics_0.4.0
>> loaded via a namespace (and not attached):
>>  [1] affxparser_1.30.0     affyio_1.26.0         Biostrings_2.26.1
>>  [4] bit_1.1-8             codetools_0.2-8       DBI_0.2-5
>>  [7] ff_2.2-7              foreach_1.4.0         GenomicRanges_1.10.1
>> [10] IRanges_1.16.2        iterators_1.0.6       parallel_2.15.1
>> [13] preprocessCore_1.20.0 splines_2.15.1        stats4_2.15.1
>> [16] tools_2.15.1          zlibbioc_1.4.0
>>
>>
>>
>> --
>> Sent via the guest posting facility at bioconductor.org.
>>
>> _______________________________________________
>> Bioconductor mailing list
>> Bioconductor@...
>> https://stat.ethz.ch/mailman/listinfo/bioconductor
>> Search the archives:
>> http://news.gmane.org/gmane.science.biology.informatics.conductor

_______________________________________________
Bioconductor mailing list
Bioconductor@...
https://stat.ethz.ch/mailman/listinfo/bioconductor
Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor


Gmane