9 Oct 2012 23:34
Re: coefs<-getAffinitySplineCoefficients...design error message help
Dear Franklin, I identified that the probe sequences for about 2K probes (whose probenames are always RandomGCXY_at) are not given in the annotation files and that's why you're running into this problem. I need to check with Affymetrix for the proper sequence files (maybe the sequences are available through a different strategy that I failed to notice). Apologies for the inconvenience, benilton On 8 October 2012 13:34, Benilton Carvalho <beniltoncarvalho@...> wrote: > Franklin, I'm currently away. Please hold tight and I'll get back to you as > soon as I get to a computer. > benilton > > -- > Sent from a mobile device. > > On Oct 7, 2012 10:33 PM, "Franklin Johnson [guest]" <guest@...> > wrote: >> >> >> Dear Help, >> >> After loading the pd.Citrus library and checking the DataFrame, I ran >> > the R code for: >> 1) 'oligo' >> >> > {> library(pd.citrus) >> > Loading required package: RSQLite >> > Loading required package: DBI >> > > data(pmSequence) >> > >> > > show(pmSequence) >> > DataFrame with 341730 rows and 2 columns >> > fid sequence >> > <integer> <DNAStringSet> >> > 1 990 GCTTTTGGAACGATGGCGATGGCTA >> > 2 991 CGACGGGTTGCCTTCGGAGCTAAAT >> > 3 992 TACTGCAGAAGACCATTACCCTACA >> > 4 993 TCACATAGCTGTGCAAGGACCGTAT >> > 5 994 TCGCCTAGCAAAGCTGCCAGCATGT >> > 6 995 TTACGTCTACGTGGTGGTGCTAAGA >> > 7 996 CCGAACGACCTGTTGGACCAAAGCA >> > 8 999 AAGCTAGTCTAGCTCCACCGACGGC >> > 9 1000 TTTTCACCGGTGACGTGCCGGTCGC >> > ... ... ... >> > 341722 963599 AAATTCGACATTTTCTTTACTGAGA >> > 341723 963790 GGATGCCCTCCGGTAATTGAATCAT >> > 341724 963802 GTTCAGCTCAAACCCTACATAGAGA >> > 341725 963818 GGAAAAATGTCTCAACCAGCTGGTT >> > 341726 963841 GAGAAGATGTTCAGAGGGCCCTACA >> > 341727 963859 GGTGCAGTTCGACTCTAAGTTTGCT >> > 341728 963863 AAACACGGTTATTCATCTGCGAAAC >> > 341729 963874 GATGCTCTTCATTGGGAGGCAGCGA >> > 341730 963889 ATTGATACAGCCTTCTCTGCAGTAA >> > > getwd() >> > [1] "C:/Users/franklin.johnson.PW50-WEN/Desktop/GSE33964_citrus epi >> > cells/exData"} >> > >> > {library(oligo) >> > > celFiles<-list.celfiles("exData", full.names=TRUE) >> > > affyCit<-read.celfiles("GSM839728_GF_28mm_EC-1.CEL", >> > "GSM839729_GF_28mm_EC-2.CEL", "GSM839730_GF_28mm_EC-3.CEL", >> > "GSM839731_GF_28mm_PC-1.CEL", "GSM839732_GF_28mm_PC-2.CEL", >> > "GSM839733_GF_28mm_PC-3.CEL", "GSM839734_GF_41mm_EC-1.CEL", >> > "GSM839735_GF_41mm_EC-2.CEL", "GSM839736_GF_41mm_EC-3.CEL", >> > "GSM839737_GF_41mm_PC-1.CEL", "GSM839738_GF_41mm_PC-2.CEL", >> > "GSM839739_GF_41mm_PC-3.CEL", pkgname="pd.citrus") >> > Platform design info loaded. >> > Reading in : GSM839728_GF_28mm_EC-1.CEL >> > Reading in : GSM839729_GF_28mm_EC-2.CEL >> > Reading in : GSM839730_GF_28mm_EC-3.CEL >> > Reading in : GSM839731_GF_28mm_PC-1.CEL >> > Reading in : GSM839732_GF_28mm_PC-2.CEL >> > Reading in : GSM839733_GF_28mm_PC-3.CEL >> > Reading in : GSM839734_GF_41mm_EC-1.CEL >> > Reading in : GSM839735_GF_41mm_EC-2.CEL >> > Reading in : GSM839736_GF_41mm_EC-3.CEL >> > Reading in : GSM839737_GF_41mm_PC-1.CEL >> > Reading in : GSM839738_GF_41mm_PC-2.CEL >> > Reading in : GSM839739_GF_41mm_PC-3.CEL >> > > pmSeq<-pmSequence(affyCit) >> > > pmSeq[1:10] >> > A DNAStringSet instance of length 10 >> > width seq >> > [1] 25 GCTTTTGGAACGATGGCGATGGCTA >> > [2] 25 CGACGGGTTGCCTTCGGAGCTAAAT >> > [3] 25 TACTGCAGAAGACCATTACCCTACA >> > [4] 25 TCACATAGCTGTGCAAGGACCGTAT >> > [5] 25 TCGCCTAGCAAAGCTGCCAGCATGT >> > [6] 25 TTACGTCTACGTGGTGGTGCTAAGA >> > [7] 25 CCGAACGACCTGTTGGACCAAAGCA >> > [8] 25 AAGCTAGTCTAGCTCCACCGACGGC >> > [9] 25 TTTTCACCGGTGACGTGCCGGTCGC >> > [10] 25 GGTTAAGCCCGGCACTATCCGGGCA >> > > pmsLog2<-log2(pm(affyCit)) >> > > plot(pmsLog2) #the plots looks good across arrays (object=affyCit) >> > >> > However, still get: >> > coefs<-getAffinitySplineCoefficients(pmsLog2, pmSeq) >> > Error in model.frame.default(formula = intensities ~ design, >> > drop.unused.levels = TRUE) : >> > variable lengths differ (found for 'design') >> >> I have been working on the issue for two weeks already. >> For example, above I loaded the Citrus.pd, additionally, I tried working >> with library(citruscdf), although this did not work either? >> Moreover, I used R 2.6 with the devel 'affyio' package version 1.27.1, but >> cannot run 'oligo' with R 2.6 for some reason (i.e. error in list.celFiles >> and read.celfiles commands), although R version for 'oligo' is 2.15 or >> greater, so cannot use the list matrix generated in 'affyio' version 1.27 on >> R 2.6 cause is does not seem compatible with 'oligo' version 1.22 on R 2.6. >> I am also using the recently updated BioC version 2.11. >> In oligo using R v. 2.15, I am able to view the .CEL images, make >> boxplots, MAplots of the data, but cannot proceed beyond this point (as >> indicated above). >> >> In summary, is this a bug in the 'oligo' package?? >> >> Any assistance is greatly appreciated. >> If you have questions or need additional information, please feel free to >> contact me. >> >> Best Regards, >> >> Franklin >> >> -- output of sessionInfo(): >> >> >> > sessionInfo() >> R version 2.15.1 (2012-06-22) >> Platform: i386-pc-mingw32/i386 (32-bit) >> locale: >> [1] LC_COLLATE=English_United States.1252 >> [2] LC_CTYPE=English_United States.1252 >> [3] LC_MONETARY=English_United States.1252 >> [4] LC_NUMERIC=C >> [5] LC_TIME=English_United States.1252 >> attached base packages: >> [1] stats graphics grDevices utils datasets methods base >> other attached packages: >> [1] oligo_1.22.0 Biobase_2.18.0 oligoClasses_1.20.0 >> [4] BiocInstaller_1.8.1 BiocGenerics_0.4.0 >> loaded via a namespace (and not attached): >> [1] affxparser_1.30.0 affyio_1.26.0 Biostrings_2.26.1 >> [4] bit_1.1-8 codetools_0.2-8 DBI_0.2-5 >> [7] ff_2.2-7 foreach_1.4.0 GenomicRanges_1.10.1 >> [10] IRanges_1.16.2 iterators_1.0.6 parallel_2.15.1 >> [13] preprocessCore_1.20.0 splines_2.15.1 stats4_2.15.1 >> [16] tools_2.15.1 zlibbioc_1.4.0 >> >> >> >> -- >> Sent via the guest posting facility at bioconductor.org. >> >> _______________________________________________ >> Bioconductor mailing list >> Bioconductor@... >> https://stat.ethz.ch/mailman/listinfo/bioconductor >> Search the archives: >> http://news.gmane.org/gmane.science.biology.informatics.conductor _______________________________________________ Bioconductor mailing list Bioconductor@... https://stat.ethz.ch/mailman/listinfo/bioconductor Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor
RSS Feed